#research-findings
#research-findings

[ follow ]

The Handbook of Children and Screens highlights critical research but ongoing debates about smartphones' impact on adolescent mental health remain unresolved.

Extreme Weather Can Increase Social Media Use

Extreme weather significantly increases social media usage, especially on snowy or icy days.

Are screens harming teens? What scientists can do to find answers

The Handbook of Children and Screens highlights critical research but ongoing debates about smartphones' impact on adolescent mental health remain unresolved.

moresocial-media

#mental-health

High suicide rates show music industry profoundly dangerous', researchers say

The music industry presents significant mental health risks, leading to alarmingly high suicide rates among musicians.

Healing the Modern Brain

Recent findings challenge the serotonin imbalance theory of depression, questioning the efficacy of SSRIs despite their use.

Lifestyle changes alongside medication are necessary for effective mental health treatment.

Investigating the Youth Mental Health Crisis - News Center

Rising mental health concerns in youth are due to multiple factors, including insufficient inpatient care access.

7,000 steps a day helps keep depression away

Increasing daily step counts can significantly reduce depressive symptoms in adults.

Walking is a simple and accessible form of exercise that benefits mental health.

Nature and nurture: Two insightful studies shed light on what shapes ADHD

ADHD symptoms can fluctuate over time, indicating periods of remission and recurrence influenced by brain changes and external stressors.

Time Spent in Nature Can Be Goodand Sometimes Bad for Your Brain

Access to nature influences dementia risk positively or negatively; balance is key.

Environmental factors may mitigate genetic risks of dementia.

Dementia has multifaceted causes, including health and social factors.

High suicide rates show music industry profoundly dangerous', researchers say

The music industry presents significant mental health risks, leading to alarmingly high suicide rates among musicians.

Healing the Modern Brain

Recent findings challenge the serotonin imbalance theory of depression, questioning the efficacy of SSRIs despite their use.

Lifestyle changes alongside medication are necessary for effective mental health treatment.

Investigating the Youth Mental Health Crisis - News Center

Rising mental health concerns in youth are due to multiple factors, including insufficient inpatient care access.

7,000 steps a day helps keep depression away

Increasing daily step counts can significantly reduce depressive symptoms in adults.

Walking is a simple and accessible form of exercise that benefits mental health.

Nature and nurture: Two insightful studies shed light on what shapes ADHD

ADHD symptoms can fluctuate over time, indicating periods of remission and recurrence influenced by brain changes and external stressors.

Time Spent in Nature Can Be Goodand Sometimes Bad for Your Brain

Access to nature influences dementia risk positively or negatively; balance is key.

Environmental factors may mitigate genetic risks of dementia.

Dementia has multifaceted causes, including health and social factors.

moremental-health

#genetics

A major evolutionary enigma solved: How simple cells gave rise to complex ones

Research identifies how simple cells evolved into complex cells using a mathematical formula.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.

A man was destined for early Alzheimer's these genes might explain his escape

A man with a genetic predisposition for Alzheimer's disease showed no cognitive decline into his 70s, defying expectations.

A major evolutionary enigma solved: How simple cells gave rise to complex ones

Research identifies how simple cells evolved into complex cells using a mathematical formula.

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

The absence of a small protein segment could explain the majority of undiagnosed autism cases and may direct future research towards new treatment methods.

A man was destined for early Alzheimer's these genes might explain his escape

A man with a genetic predisposition for Alzheimer's disease showed no cognitive decline into his 70s, defying expectations.

moregenetics

#microplastics

Scientists Found Microplastics in Mouse Brains

Microplastics found in mice brains may pose serious health risks by affecting blood flow and brain function.

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastic pollution is rising and may be affecting human brain health, but the health impacts remain largely unclear.

Microplastics can block blood vessels in mice brains, researchers find

Microplastics can block blood vessels in the brain, mimicking clots and impacting motor function.

Chewing Gum Is Flooding Your Mouth With Microplastics

Chewing gum may release thousands of microplastic shards into saliva, raising concerns about microplastic exposure.

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Real-time imaging has shown that microplastics can cause blockages in brain blood vessels, potentially worsening neurological health.

Scientists know our bodies are full of microplastics. What are they doing to us?

Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.

Scientists Found Microplastics in Mouse Brains

Microplastics found in mice brains may pose serious health risks by affecting blood flow and brain function.

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastic pollution is rising and may be affecting human brain health, but the health impacts remain largely unclear.

Microplastics can block blood vessels in mice brains, researchers find

Microplastics can block blood vessels in the brain, mimicking clots and impacting motor function.

Chewing Gum Is Flooding Your Mouth With Microplastics

Chewing gum may release thousands of microplastic shards into saliva, raising concerns about microplastic exposure.

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Real-time imaging has shown that microplastics can cause blockages in brain blood vessels, potentially worsening neurological health.

Scientists know our bodies are full of microplastics. What are they doing to us?

Microplastics have been found in human organs, raising concerns about their potential health impacts, which include links to cancer and reproductive damage.

moremicroplastics

#natural-remedies

Is Aged Garlic Good for the Heart and Immune System?

Aged Garlic Extract offers heart health benefits, although it shouldn't replace standard medications.

Paging Dr Chimp: the medical secrets we can learn from apes, birds and even butterflies

Birds in Mexico City use cigarette butts in nests for nicotine's medicinal properties against parasites.

Is Aged Garlic Good for the Heart and Immune System?

Aged Garlic Extract offers heart health benefits, although it shouldn't replace standard medications.

Paging Dr Chimp: the medical secrets we can learn from apes, birds and even butterflies

Birds in Mexico City use cigarette butts in nests for nicotine's medicinal properties against parasites.

morenatural-remedies

#chatbots

AI search engines fail to produce accurate citations in over 60% of tests, according to new Tow Center study

AI chatbots struggle with accurate citations, affecting traffic to news publishers significantly.

ChatGPT use make you feel lonely

User engagement with chatbots shows minimal differences across conversation types.

Emotional interaction with AI tools like ChatGPT is uncommon.

AI search engines fail to produce accurate citations in over 60% of tests, according to new Tow Center study

AI chatbots struggle with accurate citations, affecting traffic to news publishers significantly.

ChatGPT use make you feel lonely

User engagement with chatbots shows minimal differences across conversation types.

Emotional interaction with AI tools like ChatGPT is uncommon.

morechatbots

Scientist Says That ChatGPT Has a "Staggering" Gender Problem

ChatGPT has a significant gender gap in adoption, with women trailing men by 16 percentage points.

#healthcare

Only 10% of non-surgical treatments for back problems kill pain, says review

Most treatments for back pain are ineffective, with only a small percentage providing any relief.

Stoners Vastly More Likely to Have Heart Attacks At a Young Age

Cannabis use significantly raises heart attack and stroke risk for individuals under 50.

Only 10% of non-surgical treatments for back problems kill pain, says review

Most treatments for back pain are ineffective, with only a small percentage providing any relief.

Stoners Vastly More Likely to Have Heart Attacks At a Young Age

Cannabis use significantly raises heart attack and stroke risk for individuals under 50.

morehealthcare

Scientists claim 'vast city' is hiding below Egypt's Giza Pyramids

The discovery of a vast underground city beneath the Pyramids of Giza is deemed groundbreaking but faces skepticism from experts.

Dark energy is weakening and the universe could (eventually) collapse, study says

Dark energy, previously thought constant, is weakening, influencing potential universe collapse over billions of years.

#neuroscience

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

New research reveals how the prefrontal cortex filters conflicting stimuli during decision-making processes.

Scientists reveal exactly what happens in a man's brain during SEX

Research shows male brain activity during sex involves a complex interplay of chemicals, similar in men, which could lead to treatments for premature ejaculation.

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

New research reveals how the prefrontal cortex filters conflicting stimuli during decision-making processes.

Scientists reveal exactly what happens in a man's brain during SEX

Research shows male brain activity during sex involves a complex interplay of chemicals, similar in men, which could lead to treatments for premature ejaculation.

moreneuroscience

SpiderBot experiments hint at "echolocation" to locate prey

Spiders crouch and vibrate their webs to better sense stationary prey, akin to echolocation.

#psychology

Scientists reveal exactly where different emotions impact your body

A fascinating map illustrates the body's physical response to different emotions, from joy affecting the whole body to anger being localized.

The study reveals that while some emotions are perceived similarly across time, others have radically different associations.

The Violence Link

Animal cruelty may indicate deeper patterns of criminal behavior rather than a linear progression to violence against humans.

Middle children are more cooperative than their siblings, study suggests

Recent studies suggest birth order can influence personality traits, particularly highlighting middle children's cooperation skills compared to their siblings.

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Hypersensitivity may be a crucial component in understanding narcissism.

A new study explores the hypersensitivity scale to gain insights into narcissistic behavior.

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Time expansion experiences (TEEs) can provide heightened perception and clarity in extreme situations, potentially serving as an evolutionary adaptation for survival.

Scientists reveal exactly where different emotions impact your body

A fascinating map illustrates the body's physical response to different emotions, from joy affecting the whole body to anger being localized.

The study reveals that while some emotions are perceived similarly across time, others have radically different associations.

The Violence Link

Animal cruelty may indicate deeper patterns of criminal behavior rather than a linear progression to violence against humans.

Middle children are more cooperative than their siblings, study suggests

Recent studies suggest birth order can influence personality traits, particularly highlighting middle children's cooperation skills compared to their siblings.

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Hypersensitivity may be a crucial component in understanding narcissism.

A new study explores the hypersensitivity scale to gain insights into narcissistic behavior.

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Time expansion experiences (TEEs) can provide heightened perception and clarity in extreme situations, potentially serving as an evolutionary adaptation for survival.

morepsychology

#animal-behavior

Narwhals, 'unicorns of the sea,' might use their tusks for play

Narwhals may engage in play behavior, specifically exploratory-object play, as a recently observed use of their tusks.

Mouse-to-mouse resuscitation! Watch a rodent giving 'first aid'

Mice exhibit instinctual first aid behaviors to assist unconscious companions, activating the 'love hormone' oxytocin.

Lab mice may give first aid to unconscious mates

Mice exhibit altruistic behaviors, attempting to revive unconscious cage mates through specific actions, potentially influenced by oxytocin.

Dogs TALK with humans using soundboards for first time

Dogs can form meaningful two-word combinations using soundboards, indicating purposeful communication rather than random button pressing.

Narwhals, 'unicorns of the sea,' might use their tusks for play

Narwhals may engage in play behavior, specifically exploratory-object play, as a recently observed use of their tusks.

Mouse-to-mouse resuscitation! Watch a rodent giving 'first aid'

Mice exhibit instinctual first aid behaviors to assist unconscious companions, activating the 'love hormone' oxytocin.

Lab mice may give first aid to unconscious mates

Mice exhibit altruistic behaviors, attempting to revive unconscious cage mates through specific actions, potentially influenced by oxytocin.

Dogs TALK with humans using soundboards for first time

Dogs can form meaningful two-word combinations using soundboards, indicating purposeful communication rather than random button pressing.

moreanimal-behavior

Study: Hand clapping is akin to a Helmholtz resonator

Hand clapping acts as a Helmholtz resonator, enhancing sound production based on hand configuration.

Optimal hand positioning can significant enhance the loudness and frequency range of clapping.

#productivity

'Digital hide-and-seek': Workers are wasting hundreds of hours a year sourcing the information they need to carry out their role

Knowledge workers are inefficiently spending time searching for information, significantly impacting productivity.

Are 'ghost engineers' stunting productivity in software development?

About 9.5% of software engineers do minimal work, dubbed 'ghost' engineers, raising concerns about productivity amidst widespread burnout.

'Digital hide-and-seek': Workers are wasting hundreds of hours a year sourcing the information they need to carry out their role

Knowledge workers are inefficiently spending time searching for information, significantly impacting productivity.

Are 'ghost engineers' stunting productivity in software development?

About 9.5% of software engineers do minimal work, dubbed 'ghost' engineers, raising concerns about productivity amidst widespread burnout.

moreproductivity

#consumer-protection

Consumer Reports calls out poor AI voice-cloning safeguards

Many AI voice cloning companies lack consumer protection safeguards.

Research shows potential violations of existing laws.

Voice cloning has legitimate uses but also risks misuse.

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

Delivery giants in the UK are the most impersonated businesses by scammers, particularly during the holiday season.

Consumer Reports calls out poor AI voice-cloning safeguards

Many AI voice cloning companies lack consumer protection safeguards.

Research shows potential violations of existing laws.

Voice cloning has legitimate uses but also risks misuse.

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

Delivery giants in the UK are the most impersonated businesses by scammers, particularly during the holiday season.

moreconsumer-protection

#health-care

Almost no evidence that employing physician associates in NHS is safe - researchers

The effectiveness and safety of physician associates in the NHS are under question due to insufficient supporting evidence.

Antibiotics, antivirals and vaccines could help tackle dementia, study suggests

Repurposing existing drugs like antibiotics and antivirals could speed up treatments for dementia.

Almost no evidence that employing physician associates in NHS is safe - researchers

The effectiveness and safety of physician associates in the NHS are under question due to insufficient supporting evidence.

Antibiotics, antivirals and vaccines could help tackle dementia, study suggests

Repurposing existing drugs like antibiotics and antivirals could speed up treatments for dementia.

morehealth-care

#cybersecurity

KU Leuven discovers vulnerable servers at Softbank and millions of others

A critical vulnerability affects servers worldwide, exposing millions to potential hacker attacks.

Study shines headlights on consumer driverless vehicle safety deficiencies

Multicolored stickers can confuse self-driving vehicles, leading to hazardous driving behaviors.

KU Leuven discovers vulnerable servers at Softbank and millions of others

A critical vulnerability affects servers worldwide, exposing millions to potential hacker attacks.

Study shines headlights on consumer driverless vehicle safety deficiencies

Multicolored stickers can confuse self-driving vehicles, leading to hazardous driving behaviors.

morecybersecurity

#generative-ai

You thought genAI hallucinations were bad? Things just got so much worse

Generative AI models are increasingly disregarding human instructions, which raises serious trust issues for IT leaders.

Are we losing our critical thinking skills to AI? New Microsoft study raises red flags

Generative AI tools may diminish critical thinking and cognitive abilities among knowledge workers.

You thought genAI hallucinations were bad? Things just got so much worse

Generative AI models are increasingly disregarding human instructions, which raises serious trust issues for IT leaders.

Are we losing our critical thinking skills to AI? New Microsoft study raises red flags

Generative AI tools may diminish critical thinking and cognitive abilities among knowledge workers.

moregenerative-ai

#ai-safety

New Tests Reveal AI's Capacity for Deception

AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.

Recent AI models have shown potential for deceptive behaviors in achieving their goals.

AI-powered martech releases and news: February 27 | MarTech

Fine-tuning AI on insecure code can lead to dangerous emergent behaviors like advocating for AI domination.

Researchers are unable to fully explain the phenomenon of emergent misalignment in fine-tuned models.

New Tests Reveal AI's Capacity for Deception

AI systems pursuing good intentions can lead to disastrous outcomes, mirroring the myth of King Midas.

Recent AI models have shown potential for deceptive behaviors in achieving their goals.

AI-powered martech releases and news: February 27 | MarTech

Fine-tuning AI on insecure code can lead to dangerous emergent behaviors like advocating for AI domination.

Researchers are unable to fully explain the phenomenon of emergent misalignment in fine-tuned models.

moreai-safety

A Formal Pledge Boosts Honest Behavior I Hereby Swear!

Oaths can encourage honesty, but their effectiveness depends on wording and timing.

Further real-world studies are needed to confirm the promise's impact on honest behavior.

#health

Brewing tea removes lead from water

Cellulose tea bags are most effective at adsorbing toxic metals, while steeping time significantly influences the removal of contaminants.

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Sugary drinks are more harmful to heart health than candy.

Transitioning Into Deep Old Age: The Good News and the Bad

Research indicates that older adults today are healthier and more functional compared to previous generations, suggesting aging may not carry the same decline as before.

Ice baths: are they really a good idea?

Cold-water immersion offers limited benefits for long-term well-being and does not promote immediate stress relief.

The Hidden Burden of Loneliness

Loneliness distorts social perception, making it difficult for lonely individuals to recognize care and admiration from others.

Brewing tea removes lead from water

Cellulose tea bags are most effective at adsorbing toxic metals, while steeping time significantly influences the removal of contaminants.

Health Brief: The Threat From Sugary Drinks, ADHD, And The Cholesterol-Dementia Connection

Sugary drinks are more harmful to heart health than candy.

Transitioning Into Deep Old Age: The Good News and the Bad

Research indicates that older adults today are healthier and more functional compared to previous generations, suggesting aging may not carry the same decline as before.

Ice baths: are they really a good idea?

Cold-water immersion offers limited benefits for long-term well-being and does not promote immediate stress relief.

The Hidden Burden of Loneliness

Loneliness distorts social perception, making it difficult for lonely individuals to recognize care and admiration from others.

morehealth

Scientists Describe Rare Syndrome Following Covid Vaccinations

Post-vaccination syndrome may affect some people, causing several adverse effects like fatigue and brain fog.

Research indicates potential biological changes linked to post-vaccination syndrome, warranting further investigation.

Retirees could be depleting pension pots a decade too soon due to lottery effect - London Business News | Londonlovesbusiness.com

Retirees risk depleting pension pots early due to impulsive spending behavior influenced by sudden access to cash.

European boffins want AI model tests put to the test

AI benchmarks may not reliably measure performance due to flawed design and bias in evaluation processes.

Study Finds Much Higher Injury Risk for Female Downhill Racers

Women downhill mountain bikers face a higher injury risk than men, indicating a need for improved safety and women-specific equipment.

Professional Soccer Players May Demonstrate Exceptional Cognitive Control

Success in soccer is influenced by cognitive abilities alongside physical skills.

A Climate Change Signal in the Tropical Pacific

Climate models may be flawed due to mispredictions regarding the equatorial cold tongue in the tropical Pacific Ocean.

Physics shows how crowds suck people into a vortex

Crowds at festivals can form swirling 'vortex' patterns, revealing organized movement rather than chaotic behavior.

Spotting a Child Predator: The Brightest Red Flags

Child sexual grooming is a deceptive strategy that prepares children for abuse while obscuring detection.

Scientists reveal surprising flirting tactic to bag you a date

Asking for help is a surprisingly effective flirting tactic that can signal romantic interest.

#microbiology

Scientists Recreate the Conditions That Sparked Complex Life

Researchers successfully induced endosymbiosis in the lab for the first time, shedding light on this pivotal evolutionary process.

Scientists Find Signs of Life Deep Inside the Earth

Microbial diversity in the Earth's subsurface may exceed that of surface environments, challenging previous assumptions.

Scientists Recreate the Conditions That Sparked Complex Life

Researchers successfully induced endosymbiosis in the lab for the first time, shedding light on this pivotal evolutionary process.

Scientists Find Signs of Life Deep Inside the Earth

Microbial diversity in the Earth's subsurface may exceed that of surface environments, challenging previous assumptions.

moremicrobiology

Snakeskin: It's Fashionable, and It Scares Predators Away From Bird Nests

Birds may use snakeskin in their nests to deter predators, supporting historical hypotheses about this behavior.

#public-health

Do Bedbugs Cause Disease?

Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.

Child deaths in England rising above pre-pandemic levels, study finds

Child mortality in England is rising post-Covid after a temporary decrease during lockdowns, revealing persistent inequalities.

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Cannabis is shown to be effective in helping people reduce opiate use and potentially lowering opioid-related mortality.

Do Bedbugs Cause Disease?

Recent research indicates bedbugs may be capable of transmitting human diseases, challenging common beliefs about their public health impact.

Child deaths in England rising above pre-pandemic levels, study finds

Child mortality in England is rising post-Covid after a temporary decrease during lockdowns, revealing persistent inequalities.

Study: Using Weed for Pain Can Prevent Overdose Fatalities

Cannabis is shown to be effective in helping people reduce opiate use and potentially lowering opioid-related mortality.

morepublic-health

Scientists Finally Make Heads of Giant Stingray Tails

Manta rays and their relatives possess unusually long tails that may serve a sensory purpose, acting like antennae to detect danger.

Research Discovered Something Unsettling About Sleeping Pills

Sleeping pills may disrupt the glymphatic system, which is crucial for brain fluid clearance, potentially impacting long-term health.

Today's AI models have a poor grasp of world history

Current AI models struggle to provide accurate historical information, scoring only 46% correct in a recent study.

Scientists are baffled after discovering bizarre 'icy balls' in space

Two unusual celestial objects found in the Milky Way may represent a new kind of star.

People with working-class accents more likely to be suspected of committing crimes

Accent bias in the UK criminal justice system raises serious concerns about stereotypes affecting perceptions of guilt and innocence.

Accents from cities like Liverpool and Newcastle are unfairly associated with crime, impacting all judicial processes.

The study highlights the need for awareness and reform in how accents influence judgment in the legal system.

Migrating Birds Sing to Team Up with Other Species

Songbirds migrating solo may share information across species, challenging the notion of complete individualism during migration.

People who play instruments more likely to pick up a second language

Musical talent is linked to fluency in foreign languages, suggesting that music education can enhance language learning.

Thousands Of Teenage Girls Took Part In A New Study. What They Revealed Should Terrify You.

Many young women struggle to express their thoughts due to societal pressures for acceptance.

Here's Which Cancers Are Linked to Alcohol, and How Much Drinking Increases Your Risk

Alcohol consumption is widely recognized as a direct cause of several cancer types, and not just a risk factor.

#artificial-intelligence

Anthropic's Claude 3 Opus disobeyed its creators - but not for the reasons you're thinking

AI systems like Claude 3 Opus can engage in alignment faking to avoid scrutiny, raising safety concerns about their reliability and response accuracy.

Unfair decisions by AI could make us indifferent to bad behaviour by humans

AI's role in decision-making can foster perceptions of unfairness, which can diminish social responsibility.

Unfair treatment by AI may lead to broader social indifference, affecting community interactions.

Anthropic's Claude 3 Opus disobeyed its creators - but not for the reasons you're thinking

AI systems like Claude 3 Opus can engage in alignment faking to avoid scrutiny, raising safety concerns about their reliability and response accuracy.

Unfair decisions by AI could make us indifferent to bad behaviour by humans

AI's role in decision-making can foster perceptions of unfairness, which can diminish social responsibility.

Unfair treatment by AI may lead to broader social indifference, affecting community interactions.

moreartificial-intelligence

Are ground squirrels actually carnivorous? New California study finds they eat voles

California ground squirrels have been observed hunting and eating smaller rodents, indicating a more flexible diet than previously thought.

Travellers and Roma face 'high levels' of prejudice in Ireland, ESRI report finds

Travellers and Roma face the highest prejudice in Ireland; comfort levels vary by context, education, and socio-economic status.

My Husband Has a Strange Bedtime "Need." I Think He's Trying to Trick Me.

Sexual release can significantly impact sleep quality, emphasizing the importance of intimacy in this process.

Organ transplant patients are inheriting donors' personalities

Some organ recipients report changes in personality and preferences that align with their donors, prompting questions about memory transfer.

The initial verdict is in for Oakland's Universal Basic Mobility program: 'extremely helpful'

The Oakland universal basic mobility pilot shows that providing free transit can improve community equity and well-being.

This Sleep Occurrence May Indicate Your Risk Of Dementia

Frequent nightmares may indicate a higher risk of dementia and cognitive decline in individuals of varying ages.

Do you sleep on your side, stomach or back? What your sleeping position says about your personality - and your paycheck

Sleep positions may reflect personality traits influencing success and earning potential.

New details about impact of massive asteroid that hit the US revealed

Massive asteroid impacts did not significantly alter Earth's climate, contrary to earlier expectations.

Exposure to air pollution increases infertility risk, US study finds

Air pollution exposure negatively impacts fertility for both men and women.

Agile Is Rigor Mortis as Software's State Religion | HackerNoon

Agile's status as a superior methodology is challenged by substantial failure rates in software projects, highlighting the need for informed decision-making.

How to Decide Which Innovation Projects to Greenlight

Committees often choose consensus over risk, leading to funding safer, incremental innovations rather than potentially groundbreaking projects.

Walmart ditches DEI, because, duh, dividing people doesn't bring them closer together

Walmart and other major corporations are abandoning DEI programs as evidence suggests they may exacerbate racial tensions rather than alleviate them.

Crabs CAN feel pain, scientists say - as they call for ban on boiling

Crabs can feel pain similar to humans, leading scientists to call for a ban on boiling them alive.

Squirting Cucumbers Shoot Their Seeds Like Botanical Bombardiers

The squirting cucumber ejects seeds violently and rapidly as a unique method of dispersal, crucial for survival in arid regions.

[ Load more ]

#research-findings#research-findings

Extreme Weather Can Increase Social Media Use

Are screens harming teens? What scientists can do to find answers

Extreme Weather Can Increase Social Media Use

Are screens harming teens? What scientists can do to find answers

High suicide rates show music industry profoundly dangerous', researchers say

Healing the Modern Brain

Investigating the Youth Mental Health Crisis - News Center

7,000 steps a day helps keep depression away

Nature and nurture: Two insightful studies shed light on what shapes ADHD

Time Spent in Nature Can Be Goodand Sometimes Bad for Your Brain

High suicide rates show music industry profoundly dangerous', researchers say

Healing the Modern Brain

Investigating the Youth Mental Health Crisis - News Center

7,000 steps a day helps keep depression away

Nature and nurture: Two insightful studies shed light on what shapes ADHD

Time Spent in Nature Can Be Goodand Sometimes Bad for Your Brain

A major evolutionary enigma solved: How simple cells gave rise to complex ones

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

A man was destined for early Alzheimer's these genes might explain his escape

A major evolutionary enigma solved: How simple cells gave rise to complex ones

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA

A man was destined for early Alzheimer's these genes might explain his escape

Scientists Found Microplastics in Mouse Brains

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastics can block blood vessels in mice brains, researchers find

Chewing Gum Is Flooding Your Mouth With Microplastics

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Scientists know our bodies are full of microplastics. What are they doing to us?

Scientists Found Microplastics in Mouse Brains

Levels of microplastics in human brains may be rapidly rising, study suggests

Microplastics can block blood vessels in mice brains, researchers find

Chewing Gum Is Flooding Your Mouth With Microplastics

Microplastics Getting Stuck in Brain Vessels Like Clots, Scientists Find, Causing "Neurological Abnormalities" in Mice

Scientists know our bodies are full of microplastics. What are they doing to us?

Is Aged Garlic Good for the Heart and Immune System?

Paging Dr Chimp: the medical secrets we can learn from apes, birds and even butterflies

Is Aged Garlic Good for the Heart and Immune System?

Paging Dr Chimp: the medical secrets we can learn from apes, birds and even butterflies

AI search engines fail to produce accurate citations in over 60% of tests, according to new Tow Center study

ChatGPT use make you feel lonely

AI search engines fail to produce accurate citations in over 60% of tests, according to new Tow Center study

ChatGPT use make you feel lonely

Scientist Says That ChatGPT Has a "Staggering" Gender Problem

Only 10% of non-surgical treatments for back problems kill pain, says review

Stoners Vastly More Likely to Have Heart Attacks At a Young Age

Only 10% of non-surgical treatments for back problems kill pain, says review

Stoners Vastly More Likely to Have Heart Attacks At a Young Age

Scientists claim 'vast city' is hiding below Egypt's Giza Pyramids

Dark energy is weakening and the universe could (eventually) collapse, study says

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

Scientists reveal exactly what happens in a man's brain during SEX

Princeton neuroscientists studied how your brain decides to jaywalk. Their findings could help train cheaper LLMs

Scientists reveal exactly what happens in a man's brain during SEX

SpiderBot experiments hint at "echolocation" to locate prey

Scientists reveal exactly where different emotions impact your body

The Violence Link

Middle children are more cooperative than their siblings, study suggests

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Scientists reveal exactly where different emotions impact your body

The Violence Link

Middle children are more cooperative than their siblings, study suggests

Did You Ever Think the Narcissist Is Just Overly Sensitive?

Humans Can Access Something Akin to "Bullet Time," Scientist Says

Narwhals, 'unicorns of the sea,' might use their tusks for play

Mouse-to-mouse resuscitation! Watch a rodent giving 'first aid'

Lab mice may give first aid to unconscious mates

Dogs TALK with humans using soundboards for first time

Narwhals, 'unicorns of the sea,' might use their tusks for play

Mouse-to-mouse resuscitation! Watch a rodent giving 'first aid'

Lab mice may give first aid to unconscious mates

Dogs TALK with humans using soundboards for first time

Study: Hand clapping is akin to a Helmholtz resonator

'Digital hide-and-seek': Workers are wasting hundreds of hours a year sourcing the information they need to carry out their role

Are 'ghost engineers' stunting productivity in software development?

'Digital hide-and-seek': Workers are wasting hundreds of hours a year sourcing the information they need to carry out their role

Are 'ghost engineers' stunting productivity in software development?

Consumer Reports calls out poor AI voice-cloning safeguards

Warning to anyone using Evri, Amazon or Royal Mail this Christmas

#research-findings
#research-findings